Home | Site Map | Site Stats | Contact Us

Welcome to the Dendrome Project!

Icon 05 TreeGenes

Sequence Resources

Summary by Genus

Colleague Directory

Colleagues Organizations

Species Database

Forest Trees

Literature Database

Search Literature

Transcriptome Database

Search Transcriptome Transcriptome Summary

Protein Database

Search Proteins Protein Summary

Expression Studies

Search Expression Expr. Studies Summary

DiversiTree

Genotype, Phenotype and Sequence CartograTree

Comparative Mapping Database

Published Maps Maps Recently Submitted Search Cmap

Genome Transcriptome Browser

GBrowse Portal

Submissions

Submit to TreeGenes

Icon 03 Updates

PineRefSeq project releases assembly (v0.8) of the Pinus teada genome | CartograTree (v2.0.0), a map interface that works with DiversiTree to bring together genomics, ecological, and trait data is now live! | SMarTForests Project releases the first assembly (v1.0) of the Picea glauca genome |

|


Search Nucleotides

Nucleotide Detail View
Description A.alba chloroplast DNA for chlB gene.
Locus X98570
Genbank Accession X98570
Genbank GI 1871512
Sequence
GAGGATCTGAAAAATTTACCAAAAGCTTGGTTCAATTT
Species Abies alba
Publication Information
TG Publication ID 8275
Title The chlB gene encoding a subunit of light-independent protochlorophyllide reductase is edited in chloroplasts of conifers
Authors Karpinska, Barbara; Hallgren, Jan-erik ; Karpinski, Stanislaw
Year 1997