Summary by Genus
Colleagues Organizations
Forest Trees
Search Literature
Search Transcriptome Transcriptome Summary
Search Proteins Protein Summary
Search Expression Expr. Studies Summary
Genotype, Phenotype and Sequence CartograTree
Published Maps Maps Recently Submitted Search Cmap
GBrowse Portal
Submit to TreeGenes
PineRefSeq project releases assembly (v0.8) of the Pinus teada genome | CartograTree (v2.0.0), a map interface that works with DiversiTree to bring together genomics, ecological, and trait data is now live! | SMarTForests Project releases the first assembly (v1.0) of the Picea glauca genome |
GAGGATCTGAAAAATTTACCAAAAGCTTGGTTCAATTT