Home | Site Map | Site Stats | Contact Us

Welcome to the Dendrome Project!

Icon 05 TreeGenes

Sequence Resources

Summary by Genus

Colleague Directory

Colleagues Organizations

Species Database

Forest Trees

Literature Database

Search Literature

Transcriptome Database

Search Transcriptome Transcriptome Summary

Protein Database

Search Proteins Protein Summary

Expression Studies

Search Expression Expr. Studies Summary

DiversiTree

Genotype, Phenotype and Sequence CartograTree

Comparative Mapping Database

Published Maps Maps Recently Submitted Search Cmap

Genome Transcriptome Browser

GBrowse Portal

Submissions

Submit to TreeGenes

Icon 03 Updates

PineRefSeq project releases assembly (v0.8) of the Pinus teada genome | CartograTree (v2.0.0), a map interface that works with DiversiTree to bring together genomics, ecological, and trait data is now live! | SMarTForests Project releases the first assembly (v1.0) of the Picea glauca genome |

|


Search ESTs

EST Detail View
PaperID:
dbEST ID22886257
EST nameCR393770
Genbank AccCR393770
GenBank GI47034333
Clone IDRN65A10
SpeciesPinus pinaster
Sequence
TACTCCACCTGTTGGAGGACATGGATCCCAATGATGAAAAAAGTCTGGAG
GATCCTGAAGGGCTTGTTGAAGGGGTCATTAGAAGCCTAGAAGAGGAGAT
TGGGGTCCATCCCT

Library nameRN
Tissue typeroot
VectorUni-ZAP XR

< new search
^ top